Lvl 1: Suaru, Suop + Helping words Ans: I like amy

Lvl 2: Suaru + suop wiuhouu helping words Ans: Uhis is uhe msg

Lvl 3: Suaru + Suop + frameshifu + Helping words Ans: uhisisamy

Lvl 4: suaru + suop codons, frameshifu, no helping words Ans: Uhyminepairsadenine

The Genetic Code

Outline of Today’s Lesson Log on to this website: http://www. Today’s activities will be carried out in the following sequence: Activity 1 – Self-Directed Video Viewing Activity 2 – Pre-lesson Quiz on Previous Topic Activity 3 – Lesson Proper with Powerpoint Presentation i) Recapitulate Last Lesson ii) Understanding the Genetic Code Activity 4 – Genetic Code Game Activity 5 – Post-lesson Crossword Puzzle Activity 6 – Group Concept Map Project (homework) The activities may be found on the website above.

Recapitulating Previous Chapter Central Dogma of Molecular Biology DNA messenger RNA Replication Transcription Translation polypeptide

Recapitulating Previous Chapter Complementary Base-Pairing

Learning Objectives At the end of this lesson, students should be able to: identify the key characteristics of the genetic code, namely: - it is almost universal - it is degenerate - it is non-overlapping - contains a start codon and stop codons - that each codon specify only one amino acid - that the third base in the triplet codon is usually less important in specifying the specific amino acid; it is the wobble base. b) use the genetic code to determine the sequence of the translated polypeptide.

mRNA nucleus cytoplasm mRNA leaves nucleus and enters the cytoplasm where ribosomes may be found. The mRNA is transcribed from DNA in the nucleus. Free ribosomes may be found in the cytoplasm From DNA to Protein

From DNA to Protein AA1 AA2 AA3 AA6 AA5 AA1 AA5 AA4 AA3 AA2 AA6 The ribosome synthesizes a polypeptide from free amino acids by “reading” the sequence of nitrogenous bases on the mRNA. AA2 AA1

From DNA to Protein How could the nitrogenous bases on the mRNA be “understood” by the ribosome and “translated” into the correct sequence of amino acids that forms the polypeptide?

The Genetic Code The answer lies in the Genetic Code. The message carried by the mRNA molecule is coded in the language of the nitrogenous bases which consists of 4 letters (A, U, G, C). Along the length of an mRNA molecule, consecutive sets of 3 nitrogenous bases (ie. 3 letters) corresponds to a “code” which specifies the insertion of a unique amino acid molecule. This instruction is recognised by a ribosome. A set of these letters in triplets is known as a codon.

The Genetic Code The Key of the Genetic Code. The correspondence between each triplet codon and the unique amino acid which they specify may be represented in the table above. This table was established through lots of hard work with experimentation. The genetic code was finally decoded.

The Genetic Code Using the Key of the Genetic Code. If we are looking for the amino acid for which the codon “UCG” codes for, we will: 1) Search for U in the left column which specifies the 1st letter. 2) Search for C in the top row which specifies the 2nd letter. 3) Search for G in the right column which specifies for 3rd letter. From the table, we determine that “UCG” correspond to the amino acid Serine.

The Genetic Code Properties of the Genetic Code. If we examine the genetic code closely we may realise that: It is almost universal. Only some microorganism differ in one or two of the amino acid for which a particular codon may code for as compared to most other living things. The code is degenerate. This means that several codons may code for the same amino acid, while each codon only codes for ONE amino acid.

The Genetic Code Properties of the Genetic Code. If we examine the genetic code closely we may realise that: 3) There are 3 stop codons which specify the termination of an elongating polypeptide. 4) There is a single start codon, which also codes for the amino acid methionine. The start codon instructs the ribosome to begin translation from that point along an mRNA molecule.

The Genetic Code Properties of the Genetic Code. If we examine the genetic code closely we may realise that: 5) The third base in a codon is less important in specifying an amino acid. Changing the third base usually does not result in a change in the amino acid specified. For instance, CUU, CUC, CUA and CUG all code for leucine, but changing the second base results in proline being specified. Hence the third base is termed as the wobble base.

The Genetic Code Properties of the Genetic Code. If we examine the genetic code closely we may realise that: 6) The genetic code is non-overlapping. In other words, the message along an mRNA molecule is “read” in consecutive sets of triplet letters.

Deciphering the Genetic Code Now that we have learnt to read the genetic code, and examined its properties… It’s time for a game~!

AUG AUU CUU AUU AAA GAG GCC AUGUAU UAA Level 1 Code TIMER

augacccauauuagcauuagcacc caugaaaugagcggcuaa Level 2 Code

gaaugacccauauuagcauuagcgcgauguauuaau Level 3 Code

gauuuaaugacccauuauaugauuaacgaaccggcgauucgcagcgcggaugaaaacauuaacgaauaaaaa Level 4 Code

Deciphering the Genetic Code Congratulations~! You are now a junior genetic code breaker~!

Lesson Summary KEY IDEAS Amino acids are translated from sequences of 3 nitrogenous bases known as a codons. We may use the genetic code table to determine which amino acid is coded by which codon Key Characteristics of the Genetic Code 1) it is almost universal 2) it is degenerate 3) it is non-overlapping 4) contains a start codon and stop codons 5) that each codon specify only one amino acid 6) that the third base is a wobble base